martes, 30 de septiembre de 2008

Un silbido desde Binigaus... y unas pruebas en Cales Coves!



Jueves 18 de setiembre. Comenzamos el día temprano. He dormido en casa de Antonio, un apartamento al lado de la playa. Antonio debe ir a su trabajo, la carpinteria Qissuk en Es Mercadal, y debe estar allá a eso de las ocho y media.

A las ocho de la mañana estamos de nuevo en Cala Galdana. Nos despedimos sabiendo que volveremos a vernos si todo va bien, el día siguiente a la tarde, cuando llegue a Es Grau habiendo completado la vuelta a la isla.

En el embarcadero de Cala Galdana me lo tomo con calma. Aprovecho para reorganizar la piragua y alimentar a unos patitos que miran con deseo mi desayuno...



Después de consultar las previsiones meteorológicas me hago a la mar a eso de las diez de la mañana. El viento de sur me acompañará todo el día... y me dejará surfear en alguna de las calas! :) Navegaré hasta Cala En Porter en solitario, donde se unirán a mi de nuevo Josep y Jose Luis.

Navego. Me adentro en todas las calas maravillosas que desde Cala Galdana hacia el este uno va encontrando: Mitjaneta, Mitjana, Trebalúger, Fustam y Escorxada. En este tramo podemos encontrar una densidad enorme de cuevas fantásticas. Pero la constante en mi vuelta ha sido la presencia de viento. Viento que me ha impedido entrar en las cuevas pero a cambio me ha dado olitas para surfear! Un par de surfeadas me dejan satisfecho en Trebalúger y decido continuar mi avance a buen ritmo.

Llego a la playa de Binigaus y avanzando por ella a unos 200 metros de la playa. De pronto escucho un fuerte silbido que me hace mirar hacia la playa. Allá veo como unas siete u ocho personas me hacen señales. Decido acercarme y desembarcar y mis sospechas se convierten en realidad! Allá encuentro a "La Mar". "La Mar" es un compañero del foro www.kayakdemar.com. En este foro habíamos quedado en encontrarnos en la isla de alguna manera. Finalmente, el encuentro fue en una de las playas mas extensas y bonita de la isla, la playa de Binigaus. Aquí os presento a "La Mar". Un abrazo chico! :)



Aprovecho para comer y hablar con "La Mar". De esa conversación nace la intención de navegar por Córcega. "La Mar" es un gran conocedor de la isla y sería fantástico compartir con él una expedición en ese gran paraíso.

Nos despedimos y pongo proa hacia Cala En Porter. En una hora y media debo estar allá para reunime con Josep y Jose Luis. Jose Luis apareció en alguna foto del primer día que vino a navegar... pero apareció bastante escondido! ;) Aquí lo podéis ver con un poquiiiiiiiiiito más de claridad ;) Un abrazo Jose Luis! :)



Esta foto, como otras que podéis ver en el pase de diapositivas que da comienzo al artículo, está realizada en Cales Coves. Para muchos, una de las calas más bonitas de la isla. Yo no acabo de decidirme por una en concreto la verdad... Menorca tiene una densidad de belleza enorme, para muchos, desconocida.

Aquí aprovechamos para probar un experimento con la cámara de fotos. El caso es que probamos algunos esquimos... con la cámara fijada a la popa! :) El resultado quedó... uhmmm.. realmente bien! :) El video... no puedo ponerlo aquí... Tengo que añadir otro articulo ya que no me permite tenerlo junto al pase de diapositivas inicial... Así que... ahora mismo lo cuelgo en otro artículo! :)

Anochece!!!! Otra vez!!! Y de nuevo, regalos en forma de puesta de sol...





Me encantan estas dos fotos. La combinación de la puesta de sol y navegante en kayak es de una plasticidad atractiva. :)

De nuevo decido finalizar la etapa antes de lo previsto. No llegaré a Binidalí. Me quedaré en Es Canutells, donde cenaré en el restaurante que lleva el mismo nombre, alzado sobre la cala, un balcón perfecto y una cena excelente!

Carles me llama. Quiere navegar conmigo la última etapa. Le pido que me deje su pala esquimal para hacer los últimos treinta y pico kilómetros que separan Es Canutells de Es Grau. Mañana, rendiré tributo a una de las personas que en mi opinión más ha hecho por fomentar el kayak esquimal en este país, Xavi Amargant. Y... ¿que mejor manera que navegar con una de sus creaciones inducidas? Navegaré con la pala esquimal de Carles. Una auténtica maravilla.

Un saludo a todos :)

lunes, 29 de septiembre de 2008

Poniente tranquilo, sur ventoso.

La noche del martes 16 de setiembre empieza con una simple ducha. Una ducha con agua caliente y dulce. Estoy en casa de Josep, en el palacio de Josep. La vida que solemos llevar cargada de prisas nos hace olvidar el sabor de las pequeñas cosas... como la ducha :) Momentos como este me hacen recordar que a veces el placer suele encontrarse en el disfrute de los pequeños detalles de lo cotidiano.

Hoy cenaremos en buena compañía. Nolo y Miriam vienen a cenar y se reuniran con nosotros cuatro, Josep, Raquel, Marina y yo. Marina anda ya un pelín cansada. La tremenda actividad que despliega durante el día hace que caiga rendida en las primeras horas de la noche. Esta sirenita de seis añitos, pura energía que devora el mundo, yace junto a nosotros sumida en un profundo sueño.

Acabamos la cena y marchamos a dormir. Hoy estoy realmente cansado y caigo rápidamente en los dominios de Morfeo.

Por la mañana, toda la familia ha marchado a trabajar. Marina con su abuelo Toyo, que me consta que suele leer habitualmente lo que aquí escribo. Un saludo Toyo! Espero conocerte pronto! :)

Hoy navegaré solo. Empezaré tarde. Hace demasiados días que no cuelgo nada en el blog y aprovecho las excelentes comunicaciones que tengo en este día. Los primeros artículos de la navegación por Menorca los cuelgo desde aquí.

A las dos del mediodia, tempranito! :) como siempre, inicio la navegación. Me esperan algo más de 30 km. por delante hoy. Si todo va bien acabaré en Santo Tomás y allá me esperan Antonio, Carles y Teresa para cenar.

Parto desde Cala En Blanes y pongo proa hacia el cabo Artrutx. Este cabo marca el final del poniente de la isla y abre las puertas del sur. La costa rocosa menorquina cambia completamente aquí, dominando el paisaje calcáreo que se funde facilmente con el embate (s'embat!) de las olas que rompen una y otra vez...

Quereis ver un ejemplo del constante desgaste? Aqui tenéis uno.

video

En su día esto fue una cueva pero el mar, con su constancia, provoco el derrumbe de la cúpula que había limado durante siglos.... Ejemplos como este pueden encontrarse a menudo en Menorca.

De mi periplo hacia Santo Tomás podría destacar las maravillosas calas y playas de la zona. A eso de las cuatro de la tarde desembarco a comer alguna cosa en la playa de Son Saura. La playa, desconocida para mí hasta ese momento, me deja maravillado. En anteriores navegaciones por la isla nunca había llegado hasta aquí. Un paraíso realmente.

Calas como Turqueta, Sant Francesc, Macarella y Macarelleta son testimonio de mi avance... lento avance! con enormes dosis de contemplación. Muchos recuerdos vuelven a mi mente de navegaciones pasadas.

Se hace de noche, como siempre. No voy a llegar a Santo Tomás y decido poner fin a la etapa de hoy en Cala Galdana. Antonio viene a recogernos. Tanto la piragua guerrera como yo hemos disfrutado de una suave brisa del sur que nos ha ido empujando. Un día fantástico. La guinda la ponen Antonio, Carles y Teresa. Una cena fantástica acompañada con las mil y una historias del gran expedicionario: Antonio Martínez.

Hoy os dejo un pase de diapositivas con las fotos que más me gustaron de este día. Gracias Germán por indicarme como utilizar esta técnica! :) Un abrazo chico! :)




Apa! Salut per a tothom. Salud para todos :)

jueves, 25 de septiembre de 2008

Freddy, Freddy Mercury! ;)

La tarde va convirtiéndose poco a poco en noche. Es la noche del lunes 15 de setiembre. Después de quedar maravillado con la entrada a Cala Morell y haber mirado con detenimiento su famoso elefante,



desembarco y me transformo en persona. La escena de las miradas atónitas viendo como uno deja de parecer un extraterrestre y pasa a ser un simple humano, se repite en cada final de etapa. Una vez convertido, miro a mi alrededor y me llama enormemente la atención una terraza que se encuentra alzada sobre la cala. "Uhmmm! Que bien! Caerá una clarita!" pienso. Me sorprende también el hecho de no encontrar ni a Josep ni a Nolo en la cala. Habíamos quedado para cenar aquí.

Me decido a subir a la terraza y allá me encuentro a un tipo muy agradable atendiendo en la barra. Buena gente, clavadito a Freddy Mercury!!!! (Un abrazo Manolo! y un abrazo Juan Carlos!) El caso es que en un primer momento yo no había caído en el parecido pero, el propio Manolo, cuando le comento que voy navegando y poniendo la aventura en un blog, me dice que ponga en el mismo que él, es el doble de Freddy!

Ahora aquí, debería poner su foto y la de su compañero Juan Carlos. Lamentablemente, las fotos que les hice las he perdido en un cambio de orden desafortunado :( Primero borré el contenido de la cámara y luego quise pasar las fotos :( En fin Manolo! Si me estás leyendo, que sepas que en octubre volveré a pasar por tu terraza, la terraza Baristiu, a probar ese magnífico flan de coco que me ofreciste y a haceros de nuevo la foto para que el mundo corrobore tu parecido con Freddy! :)

No puedo poner las fotos. Pero si un video con la vista de la cala desde la terraza Baristiu:

video

Manolo me deja uno de los baños abiertos para que, durante la noche, pueda cargar los artilugios eléctricos que llevo. Poco después de cerrar, aparece Josep, con Raquel y la sonriente Marina. Han venido cargados con una nevera con bebidas y como no, aprovechamos para extendernos en una agradable tertulia. Agradable? uhmmm.... bueno... pues si! :) Acabamos riendo con alguno de los "usos" que de la cala hacen algunos... no diré más eh Raquel? jejeje! ;)

Josep y familia marchan de retorno a casa. Yo me preparo para dormir. Decido hacerlo en una de las terrazas de cemento que están a pie de orilla. El viento sopla ligeramente y eso, para hacer un vivac al lado del mar, me encanta.

Por la mañana, a eso de las 11, Manolo abre de nuevo la terraza, junto con todos los compañeros que la atienden. El volúmen de turistas ha disminuido ya considerablemente y no pasarán problemas. Yo me instalo en un rincón, con conexión eléctrica y miro de trabajar un poquito. Si! Trabajar! Puntualmente me conecto remotamente a mi trabajo y miro de solucionar las incidencias que hayan.

Llega la hora de almorzar. Manolo me ofrece lo mejor que tiene. Me decido por una excelente pieza de atún deliciosa junto con una buena ensalada. Se acerca la hora de navegar! Hoy... a las cuatro de la tarde! Ya sabéis, siempre es recomendable empezar a navegar temprano... jejejejeje!

El caso es que Josep y Jose Luis se retrasan. Yo empiezo a prepararme y me acerco a la piragua. Empiezo a poner cada cosa en su sitio. Al lado de mi, dos encantadoras jovencitas de setenta años no resisten la curiosidad y espetan: "Vaya chico más ordenado!" Yo ante tal envite, no puedo más que iniciar una conversación que nos lleva a repasar la actualidad mundial. Ambas jovencitas, Maria Antonia y Maria Eugenia para más datos, de Valladolid y residentes en Madrid, se despiden de mí, a eso de las 5 de la tarde, una vez Josep y Jose Luis ya se han reunido conmigo y decidido a iniciar la marcha. Ambas jovencitas me deben enviar una foto que hicieron con su cámara! Espero esa foto chiquillas!!! :)

Josep me presenta a Jose Luis. Un placer conocerte chico! :) Jose Luis compartirá con nosotros dos días de navegación. Hoy será el primero. Aquí, una foto de Josep y Jose Luis:



Creedme, el que no se vé apenas, es Jose Luis! :)

Avanzamos hacia Punta Nati. Este lugar es el punto en el que pondremos fin a la navegación por el norte de la isla e iniciaremos la navegación del poniente de la misma! :)

Aquí una foto del faro de Punta Nati.



Y aquí una del paso, obligatorio!, con coctelera incluída, entre punta Nati y el islote. Pasarlo en este sentido pone punto final al norte de la isla e iniciamos la cuesta abajo ;)



El sol va cayendo y la luz maravillosa hace que todo reluzca. Aquí, incluyo tres fotos de la piragua guerrera. Con esta luz, sale siempre preciosa. Para tí Artur! esta mezcla brillante entre tu creación y el manto solar.







Avanzamos rápidamente, con ola larga de popa, que nos hace disfrutar como enanos. Jose Luis, hace sus primeros pinitos deslizándose y cogiendo las olas en este tipo de mar en lugar de evitarlas. En un momento, pasamos el Pont d'en Gil.



Y la mala costumbre de que siempre se nos haga de noche cuando navegamos, nos regala esta puesta de sol:





Llegamos a Cala en Blanes. Allá cargamos las piraguas y las llevamos a casa de Josep. Solo unos cientos de metros separan su casa de esta cala. Dormiré en el palacio de Raquel, Marina y Josep. Una delicia.

Un saludo a todos! :)

martes, 23 de septiembre de 2008

Pregonda, Algaiarencs y Morell...

Amanece. Comienza el lunes 15 de setiembre.
Es la primera noche que he estado sólo en este paseo por Menorca. La noche ha sido muy tranquila, con visitas de alguna de las muchas cabras que viven cerca del faro de Caballería. Tengo a pocos metros de mi un enorme charco producido por las fuertes lluvias de días anteriores. Ese charco sirve de abrevadero a las cabras que aprovechan los primeros rayos de sol para saciar su sed. Poco a poco vencen el miedo de ese animal extraño multicolor que yace tendido cerca del charco. Se acercan en buen número y alguna incluso, excesivamente curiosa, se atreve a acercarse a mi.

Son las siete de la mañana y me pongo en marcha. Desayuno tranquilamente y preparo todo el material. Enciendo el miniportátil y, habiendo escasa cobertura, consulto las previsiones meteorológicas. Aquí en la isla, windguru.com, es una fuente apropiada para consultar la previsión según Teresa de Menorca en kayak.

Será el primer día que navego en solitario. La previsión indica viento de norte, fuerza 4-5 Beaufort con alguna racha de fuerza 6. Para salir en estas condiciones hay que sentirse muy tranquilo navegando con viento y mar de fondo. Debe haberse navegado en esas condiciones a menudo anteriormente.

En cala Viola de Ponent, donde estoy, la orilla parece una sopa de gelatina. Estoy solo y debo arrastrar la piragua, bastante cargada, hasta un punto donde pueda partir. Para llegar a ese punto, no me queda más remedio que meter las piernas en esa sopa. Toca hacer un acto de fe! :) Llevo encima la crema solar antimedusas de una conocida marca. Será una prueba emocionante. Un ejercicio de confianza ciega, que finaliza... con éxito! Mis piernas apartan la densidad gelatinosa... sin sufrir ni tan siquiera el ataque de un dardo medusero...

Empiezo a navegar y en pocos minutos vislumbro la torre de Sanitja y el puerto del mismo nombre. Aquí una foto de la torre.



El viento va en aumento. El mar de fondo también. Me dirijo hacia cala Pregonda, una de las calas preferidas de Nolo, con intención de adentrarme en la misma y disfrutar un buen rato del lugar. De camino, saludo a un buen número de cormoranes que no parecen asustarse al verme pasar a su lado.



El mar me atiza por estribor. El sol me pega por babor. Pero el mar de fondo, ligeramente de popa, me ayuda a avanzar con comodidad y rapidez. En poco más de una hora estoy delante de cala Pregonda.



En cala Pregonda hay que ir con cuidado. Sobre todo, con viento del norte. Hace ya algunos meses, hubo aquí un incidente importante en el que varias piraguas acabaron dobladas y alguno acabó con un buen susto en el cuerpo. Después de acercarme y ver el rompiente de las olas, decido no entrar y poner proa hacia las islas Bledes. Más tarde, Carles, me comentaría que en esa situación de viento norte, la cala es accesible por un pequeño paso a la izquierda de la gran roca que nos recibe en medio de la cala. Voy sólo y prefiero no arriesgarme.

Estoy cerca de la mayor de las islas Bledes. Observo el paso existente entre ella y la gran Menorca. Aprovecho para comer alguna cosa, un huesitos! que rico! Prefiero este tipo de barritas a cualquier otra amalgama energética. Me encanta el chocolate. Mientras como, observo el paso. Hay rompiente de olas, uhmmmmm, muy dura y desordenada. Decido no pasar por este paso y bordeo la mayor de las Bledes. El día siguiente, comentándolo con Josep, me dice que es uno de los puntos más peligrosos de la isla. El fondo allá es escasamente profundo y las olas cargan con fuerza.



El viento aumenta y la mar también. Para mí se ha convertido en una sensación muy gratificante y me siento seguro y tranquilo en esas condiciones. La Mar y yo, yo y la Mar, sensación y emoción cargada de pureza y simplicidad.

La fuerza 5 de viento se consolida y el mar de fondo me obliga a alejarme bastante de la costa. Las olas empiezan a romper de manera estruendosa a unos 50 metros de la costa y me obligan a pasar de largo por Cala'n Calderer, Cala El Pilar y superar Es Cap Gros con cierta distancia de seguridad. Me acerco a Algaiarencs y la entrada se muestra visualmente complicada, con alguna rompiente de ola justo a la entrada de la misma. Algunas rocas que muestran sus dientes cerquita de la superficie producen esas rompientes.

Identifico un corredor por donde entrar a la cala, en la que dispongo de dos opciones para desembarcar. Una, totalmente encarada a norte, donde algunos surfistas están disfrutando como locos :) La otra, con algo menos de oleaje, protegida por su orientación al oeste puro. Es la playa de Es Bot. Allá, tras un ligero surfeo desembarco y me dispongo a comer. Son las tres de la tarde. Una playa fantástica, mirad:

video

Aquí empiezo a preparar el almuerzo. Para mi sorpresa, veo aparecer a la pareja de Valencia! Miguel y Marta, que estando en la otra playa, me han visto aparecer y han venido a saludarme. Una grata sorpresa. Será aqui la última vez que los vea durante la travesía.

Después del merecido descanso, vuelvo al mar. El viento y la mar siguen igual. Debo llegar a Cala Morell ya que allá me encontraré con Nolo y Josep y una cena improvisada :) Nolo finalmente no podrá aparecer, pero Josep, acompañado de Raquel y la preciosa sonrisa de Marina acuden y comparten conmigo buena parte de la tarde-noche.

Cala Morell es un lugar fantástico. Aquí teneis el famoso "elefante" situado en la entrada de la cala.



El lugar es precioso, pero la humanidad, como siempre, hace un ejercicio de presencia extrema en el mismo, consiguiendo empobrecer esta maravilla cincelada por la naturaleza.

Yo me dispongo a descansar. Desde las alturas vigilo al guerrero, que descansa tras la larga lucha:



Mañana, será un dia tranquilo. He quedado con Josep en iniciar la marcha a... las cuatro de la tarde!!! Nos acompañará también Jose Luis, que contactó conmigo precisamente a través del blog y se animará a navegar el trayecto hasta Ciutadella.

Miraré de descansar y de disfrutar del lugar en el que me encuentro. Un merecido descanso!

Un saludo a todos :)

martes, 16 de septiembre de 2008

Norte! En estado puro!

Domingo 14 de setiembre.

Hemos dormido bien. A cubierto en Son Parc, por suerte, ya que durante la noche nos ha caído algún que otro chaparrón encima. Tenemos las piraguas también junto a nosotros. Todas... menos la de Josep... que es un poquitín "Caparrut" y ha decidido dejarla en la playa... bastante alejada de nosotros... Toooooossssutttt!!!!! jejejeje!.

Miramos la previsión. Viento norte, fuerza 4 con rachas de 5, mar de fondo importante. ¿A que esperamos? :) Al agua!!!



Antes de salir de Son Parc, aprovechamos para hacer unos últimos intentos de surf. Josep consigue salir a flote de todas las caídas. Yo por el contrario me veo forzado a nadar en una de ellas. Toca pagar ronda de cervezas!

Salimos en dirección a Fornells. Empezamos a notar el mar de fondo en nuestras carnes... y estómagos! Un consejo! Nunca toméis leche ni sus derivados cuando vayáis a navegar! Si el mar se mueve, la leche puede ser mala compañera estomacal... ;)

Nos aproximamos a Fornells... y hay que pasar uno de los puntos más complicados de la isla: La Mola. La Mola es una pared vertical enorme, mirando a norte completamente. Esa orientación produce un mar casi colapsado con vientos de fuerza 5 o 6. El colapso viene dado por la ola y por su rebote.

Aquí, un fragmento de vídeo.

video

Entramos a Fornells emocionados. Ha sido muy bonito e impresionante. Nos hemos ganado una buena comida. Evidentemente, no tenemos fotos de esos momentos. Estábamos demasiado ocupados ;) A Josep le enganchan hasta en cinco ocasiones el colapso que se produce cuando la ola choca con un rebote. La sensación que produce ese momento es la de quedar suspendido en el aire y recorrer la caída del hueco producido por el vacío del choque. Impresionante :)

En Fornells encontramos a Miguel y Marta, de Valencia. Un abrazo Miguel!!!! No sufras! Estamos bien!. Marta me dice que Miguel ha pasado mala noche pensando en como estaríamos. Hemos tenido poco tiempo para hablar pero he cogido cariño a esta pareja encantadora que nos está acompañando por tierra en la vuelta.

A la tarde nos espera el cabo de Caballería y el final en Cala Viola. Allá, Nolo y Josep dejarán de acompañarme. Será la primera noche en solitario.



Comemos y empezamos a prepararnos para volver a salir. Varias personas nos observan y alguién se anima a preguntar. Bien!!! Hay que fomentar este mundillo de la piragua :) Antes de salir me animo a hacer un calentamiento con unos apoyos y algún esquimo. La gente mira con una mezcla de sorpresa e interés. Quien sabe, quizá entre los presentes haya un futuro piragüista...

Salimos y nos dirigimos hacia el cabo Caballería. Encontramos el mar en el mismo estado que lo habíamos dejado a mediodía. Olones de mar de fondo que se nos echan encima de cara. Sensaciones fantásticas. Pasamos Caballería.



El mar sigue creciendo. Nos detenemos y observamos. Estamos entre el cabo y la isla des Porros (no seáis mal pensaos...) Josep mira atentamente. El estruendo de las olas rompiendo encoge el corazón de cualquiera. Hablamos y miramos de decidir que hacer: ¿Pasamos la barra de olas? ¿Damos la vuelta a la isla y vemos que pasa? Uhmm.... Dudamos... Pero finalmente nos decidimos a dar la vuelta a la isla.

Ponemos proa hacia cala Viola de Llevant. Tenemos los olones de popa que debemos controlar si no queremos hacer una megasurfeada! (yo me contengo... jejejeje) Nolo avanza rápidamente y se aleja de nosotros. Le espera Miriam, desde hace algo más de una hora. Nervioso e impaciente, Nolo aprieta el ritmo. Josep y yo pasamos juntos la isla y aprovechamos para comentar la situación vivida unos minutos antes...

Llegamos a cala Viola tarde, a eso de las siete y media de la tarde. Nolo y Josep deben ir a Es Grau, recoger los coches, y volver a la cala para cargar las piraguas y marchar. Mañana deben trabajar. Yo empiezo a disfrutar de los primeros momentos de soledad de esta aventura. Soledad lunar para ser precisos ;)





Un abrazo a todos! :)

Por fin! Empezamos!

Sábado 13 de setiembre. He quedado en Es Grau con Nolo y Josep a las nueve y media. Empezaremos a navegar esta misma mañana. Nos volvemos a reunir! :) Vuelve a aparecer la magia que nos acompaño durante nuestro paseo en Mallorca!



Desayunamos. Y aparecen algunos amiguetes conocidos en visitas anteriores a la isla. Aparece Quim! con un tono de pelo curioso, aclarado por tanto sol de verano menorquín. Aparece Pablo, que ayuda también a Carles en las labores de monitor en Es Grau.

Hablamos y hablamos. Como siempre... empezaremos tarde! Carles y Pablo se animan a acompañarnos en este primer día. Empezamos a preparar las piraguas y conocemos a una pareja de Valencia que pasa unos dias por Menorca, aficionados a la piragua también, Miguel y Marta, buena gente! Miguel y Marta nos acompañarán en nuestro recorrido los próximos días.... nos irán vigilando desde tierra! :) Un abrazo Miguel! Un abrazo Marta! :)



Nos ponemos a cargar las piraguas. Quim y Pablo contemplan todo el montaje que llevo y se muestran atónitos. Ciertamente, llevo un hipermercado dentro de la piragua. En la foto, no se vé, pero a la derecha hay un trailer con todo el material que llevo en ella ;)



Partimos desde Es Grau. Teresa y Nuka se despiden de nosotros :) Nos espera una etapa típica del norte menorquín: mar intenso, vientos de fuerza 4 o 5, mar de fondo de un par de metros, tres en algunos momentos. Con este mar, pasamos Favaritx.



Desembarcamos a comer alguna cosa en la playa de Montgofra. Un bonito lugar para descansar un poquito y afrontar el segundo tramo del día.



Después de comer volvemos a navegar acercándonos al Port d'Addaia. Pasamos por Na Macaret y.... guuuuuuuuuaaaaaauuuuu!!! Nos sorprenden los olones de L'Olla! Una muestra de lo que ha sido una constante por el norte de la isla es este video:

video

Después nos aproximamos a Son Parc, punto donde Carles se debía despedir de nosotros. El sol va cayendo y junto con las nubes nos regala imágenes como estas:





Se puede pedir más??? Yo me quedo con las sensaciones vividas en estos momentos :)

Decidimos acompañar a Carles hasta desembarcar y... bendito descubrimiento! Nos encontramos con una playa fantástica para aprender a surfear! Tanto Nolo como Josep se deciden a hacer unos pinitos en el arte del surfeo. Aquí un ejemplo: (Video surfeando)... Nos recibe Teresa en Son Parc. Y Nuka! :) Cae la noche. Deciden quedarse a cenar. Y vuelven a caer en las redes de un par de parlanchines... jejeje! No aprenden estos dos!!! (Un abrazo Teresa! Un abrazo Carles!) Mañana partiremos hacía Cala Pregonda. Nos espera una etapa intensa, pasando por Fornells y Caballería. Será demasiado intensa...

Hasta mañana! :)

Planificar... para no cumplir!

Jueves 11 de setiembre. Llego a Menorca tarde, muy tarde, casi tocadas las doce de la noche. El avión llega con algo de adelanto y espero en el aeropuerto a que Carles, de Menorca en Kayak, llegue para ir hacia Es Grau.

Mi piragua descansa desde hace un par de semanas en casa de Nolo. Por la mañana, el dia 12, llegará a Es Grau para iniciar la vuelta. Estoy ansioso! :)

Llegamos a Es Grau. Allá me recibe Teresa (un besote Teresa!!!) Nuka (una perrita Labrador de las que no me dan pánico... encantadora!) y un par de "Moixos"... En Pitu i la Misha... Moix en menorquín significa gatito :)

La casa de Carles y Teresa es enormemente acogedora. Pero aún así mis excesos oratorios hacen que ambos no marchen a dormir antes de las dos de la mañana. Aquí os pongo una foto de tan acogedora casita, en el paraíso de Es Grau. :)



Aquí otra, ojeando la guía que acaba de publicar Sergi Lara: "Menorca. La volta en caiac i cicloturisme" Lectura muy recomendable para todo aquel que quiera navegar por la isla! :)



Amanece el día 12. Teresa tiene que abrir la tienda a las diez y decido acompañarla. Carles y Teresa forman parte del proyecto Menorca en kayak. Disponen de una base en Es Grau, donde almacenan una buena cantidad de piraguas, adecuadas para navegar por la isla. También tienen una tienda en Maó muy bien surtida. Aquí van varias fotos de sus instalaciones.






La previsión del tiempo no es buena. La posibilidad de que no empecemos a navegar durante la tarde se torna cada vez más real, hasta que finalmente, se convierte en la mejor opción. Mirad el porqué:

video

Llega la hora de almorzar. Volvemos a Es Grau. Tendremos la compañía de alguién que, a pesar de haber compartido pocos momentos con él, considero un buen amigo: Antonio.

Antonio es una persona intensa, intensísima. Esa intensidad le ha llevado a vivir una cantidad de experiencias que rebasan la imaginación de muchos de nosotros.
Y quién es ese tal Antonio preguntaréis? Ese Antonio, fue miembro de la Expedición Mapfre al Artico, junto con Ramon Larramendi, Rafael Peche y Manuel Olivera.
Existe un libro que narra la expedición desde el punto de vista de cada uno de ellos. Un libro indispensable para cualquier aventurero! El libro, "Tres años a través del Artico", es una constante muestra de la intensidad a la que uno se enfrenta en aventuras de este tipo.

La sobremesa se alarga. Carles y Teresa marchan a cumplir con las obligaciones del negocio. Antonio se queda. Alargamos la sobremesa hasta las nueve de la noche, ya en casa de Teresa. Cenamos. Cenamos y hablamos. Y vuelven a darnos las tantas. Gente como Antonio y como yo, no somos buena compañia para aquellos que no soporten a los parlanchines...

Un saludo a todos.

PD: Por fin, he encontrado un lugar donde trabajar el blog. Estoy acabando de preparar un par de artículos más que colgaré en días sucesivos... Apa! Salut!

lunes, 15 de septiembre de 2008

Una vuelta intensa.... unas comunicaciones pésimas...

Hoooooooola a todos :)

Son casi las doce de la noche. Estoy en Cala Morell.
Escribo desde una de las terrazas que quedan bastante alzadas en la cala.

Mañana, si todo va bien, finalizaré la andadura por el norte de la isla e iniciaré la segunda mitad de la misma.

El paseo por el norte está siendo intensísimo y emocionante en lo que a navegación se refiere. En cuanto a las comunicaciones, hay que decir que realmente són pésimas.

En los dias venideros iré añadiendo detalles de cada etapa de la expedición, siempre y cuando las comunicaciones acompañen. Si no fuera así, publicaré diariamente una etapa a mi vuelta a casa.

Una cosita si debo decir! Tengo un segundo colaborador confirmado! Carles y Teresa, Teresa y Carles, o sea, Menorca en kayak. A partir de ahora figurarán en mi lista de colaboradores y compartiremos esfuerzos en aportar un granito de arena a este mundillo del kayak de mar.

Bien... ahora debo marchar a descansar...

Hasta mañana! :) Un saludo a todos :)

jueves, 11 de septiembre de 2008

Mens sana in corpore sano...

Hoy he dedicado la mañana a otra de mis grandes aficiones :) El ajedrez!



Buuuuuuuuuuuueno!! :)

Ahora estoy en el aeropuerto :) Me quedan tres horas y media para tomar el avión hacia Menorca. Mañana si todo va bien, después de una comida con algunos de los amiguetes que tengo por la isla, saldremos desde Es Grau en dirección norte.

Mirando la previsión meteorológica, da la sensación de que tendremos un inicio movidito. Amenaza tormenta intensa, con posibilidad de granizo y de "Caps de fibló!".

Un cap de fibló viene a ser algo parecido a un tornado pero con orígen en el agua. Pero realmente lo que me preocupa un poco, es que pueda caernos granizo o... granazo! El granizo, si es de tamaño considerable, puede ser el peor de los fenómenos que uno puede encontrarse en el mar... si uno no lleva casco! :) Y con tanto kit, tanto kit, y no llevo casco!!! Uhmmm... tendré que pensar en algo....

Bueeeeeno! Hoy es 11 de setiembre, la Diada de Catalunya. Ayer estuve hasta las 3 de la mañana haciendo los últimos preparativos. Pude marchar a dormir tranquilo.

El día ha empezado a las 9 de la mañana. Hoy tocaba disfrutar de la fiesta mayor de Palafolls, la ciudad donde resido. Y disfrutar precisamente con el torneo de ajedrez de partidas rápidas que organizan por la fiesta mayor.

El ajedrez me ha acompañado desde mi adolescencia. Empecé a jugar a los 13 años y estuve haciéndolo regularmente durante 17 años, hasta el año 2000 precisamente. En estos 17 años pude profundizar en esta materia, llegando a adquirir un cierto nivel de maestría.

Hoy, he vuelto a pasar un buen rato. Me he reencontrado con algunos viejos conocidos y he podido disfrutar de una mañana intensa. El torneo lo hemos empezado a las 10 y se ha alargado hasta las 2 del mediodía.

El ajedrez es una materia muy apropiada para los niños, muy recomendable para la formación y la tonificación del razonamiento. Es un tópico relacionar ajedrez e inteligencia, aunque bien es cierto que el ajedrez ayuda a "engrasar" las neuronas y mejora la capacidad cognitiva y la memoria. Mens sana in corpore sano!

Tan importante como el cultivo del físico es el cultivo de la mente y el ajedrez es una buena herramienta para fortalecerla.

Aquí os añado alguna foto del torneo, en el que han participado jugadores de todas las edades. En el ajedrez, no hay segregaciones por edades y así, uno puede encontrarse al otro lado del tablero desde un niño de 6 añitos como un niño de 90! ;)

En la foto que sigue, Caballero y Quim enfrentándose en una de las partidas.



Y en esta, Bayón y yo disputando una partida que para mi desgracia, ha acabado en derrota para mí... Ando un poco oxidado! :)



Finalizado el torneo, todos hemos jugado 10 o 12 partidas.... uhmmm... no lo recuerdo exactamente en este momento, de las cuales he perdido dos, una con Bayón y otra con el vencedor del torneo, Pere Mas. Felicitats Pere!!!!

El año que viene, volveremos! y... miraré de hacer una visita algún lunes que otro a todos ellos, en su lugar de reunión, a ver si acabo de quitarme el óxido mental acumulado en estos años! :)

Mañana más! Y ya.... 100% kayak.... o como dirían algunos de mis amiguetes....
QAJAQ! Always under the skin!

Un abrazo! :)

domingo, 7 de septiembre de 2008

Y el sueño va tomando forma real...

Hoy es sábado... casi domingo! Día 7 de setiembre.
Estoy en Oporto. Ha sido un largo día, lleno de sensaciones y emociones.
Aquí me acaban de fotografiar, haciendo esta entrada del blog :)



Estoy hospedado en una pensión, concretamente en "Residencial Palanca". Para visitar la ciudad es una muy buena opción si no queremos que el presupuesto se nos dispare. A esto le unimos la calidez de la gente que lleva la pensión y obtenemos un lugar en el que uno rápidamente se siente muy cómodo. Aquí, Luiz, os envía un saludo!



Bueeeeeno... :) y.... ¿por qué estoy en Oporto???? Hace unos dias expresé un sentir que prevalece en mi vida: Hay que soñar. También explicaba la idea de como convertir esos sueños en realidad. Hablaba de planes y de ejecución de los mismos. Y en eso estoy! La ejecución del plan me ha traído a Oporto... y de aquí a Esposende ;)

Hoy, he tenido el grandísimo placer y honor de conocer a Artur Pereira.
He conocido a buena parte de su familia y he visto con mis propios ojos su sueño convertido en realidad. Ese sueño tiene un nombre: SIPRE.



A las diez y media de la mañana me he encontrado con él y me ha abierto las puertas de su casa, de par en par, como suelen hacerlo por estas tierras, según me comenta el propio Artur. Aquí en la foto, sus hijos Bruno y Artur, junto con algunos compañeros del club de piragüismo que también dirige como presidente el propio Artur, el club naútico de Fao. También, a la izquierda en la foto, pequeñito el... está Roi (espero escribir bien su nombre Artur!)



Roi es un Rhodesian Ridgeback. Justo llegar al taller de Artur nos hemos conocido Roi y yo. Nuestro primer encuentro ha sido algo tenso. Roi no sabía que yo tengo pánico a los perros, aunque de un tiempo a esta parte voy superándolo. Roi ha venido lanzado a conocerme, me ha olisqueado y me ha pedido una caricia. Yo, nervioso, le he comentado a Artur que me daban pánico los perritos. Al final de nuestra visita, Roi y yo ya eramos buenos amigos, incluso se ha tomado la confianza de jugar conmigo y meter la cabeza entre mis piernas. Un perro fantástico.

Artur es una persona hiperactiva. Irradia alegría y acción. Verle hablar de su negocio, de su familia, del club de piragüismo que dirige, es un elixir que alimenta el alma de cualquiera que esté cerca de él. Habla y se le iluminan los ojos. Habla y provoca la iluminación de los mios. Enseguida conectamos los dos y dejamos que se comuniquen nuestras almas, sin tapujos ni disfraces.

Artur me enseña su casa, su vida. Aquí va una pequeña muestra.
En primer lugar, una pequeña selección de alguna de las piraguas que fabrica:



Aquí empezamos a ver el taller. Moldes para la fabricación de los distintos modelos...



... la zona de trabajo de pinturas...



... alguna piragua con historia también. Esta que véis aqui ha estado muuuuuuuuy al norte, en Svalvard! y de ahí, hacia arriba! Ha hecho disfrutar a Artur y a algunos de sus amigos en aquellas tierras gélidas. Fijaros en el detalle de la pintura de la piragua. Está pintada a mano! Esta piragua tiene ya bastantes añitos y, la verdad, yo la noto como si estuviera satisfecha de todo lo vivido... no os parece?



Aquí podéis apreciar una vista general del taller. Artur me dice que trabajan unas diez personas aqui.



Aquí vemos a José. Artur me dice que es muy tímido y no le gustan las fotos. Pero si nos fijamos en un detalle, la foto puede resultar interesante, sobre todo para mis antiguos compañeros del club Pagaia Cap de Creus. A todos ellos, un saludo (y fijaros en la camiseta que lleva José...)



Buuuuuuuuuuuueno! Con Artur he pasado casi todo el día. Hemos compartido mesa y disfrutado de un bacalao exquisito. Aquí, en los alrededores de Oporto, se come muy bien a un precio que ni podemos soñar por tierras catalanas. Tratan muy bien tanto las carnes como el pescado rey aquí: el bacalao.

A las cinco y media de la tarde ha llegado el momento de la despedida. Artur y yo hemos llegado a un acuerdo. El me facilitará material para mis sueños. Yo miraré de promocionar sus excelentes productos, con mis expediciones y asistencias a simposiums. También le daré una ayudita tecnológica en algún que otro ámbito :)

Pronto... muy pronto... dispondré de algunas piraguas cedidas por Artur para las expediciones que me planteo en el futuro. Esas piraguas, estarán a vuestra disposición para probarlas! Por tanto! Si queréis visitar la zona del Cap de Creus y de paso probar el kevlar-carbono de SIPRE, sólo tenéis que decírmelo y estaré encantado de acompañaros por los mares cercanos a Llançà (siempre que no esté por algún mar lejano alimentando mi alma.... claro está!)

SIPRE es el primero de mis colaboradores. En estos dias que corren, estoy trabajando en diferentes contactos que he realizado. Espero que en breve, la lista de colaboradores vaya en aumento. Todo pinta por buen camino.

Antes de despedirnos, Artur me ha recomendado un paseo por Póvoa de Varzim. Dicho y hecho! Os dejo una foto aquí y un vídeo con el rugir del Atlántico, para aquellos que no lo han visto nunca. El mediterráneo es un bonito... lago? ;) Me quedo con el cantábrico y con el atlántico para disfrutar de sus olas...




video

Por último! Si en tu esfuerzo de lectura has llegado aquí... te pido un esfuerzo de escritura ahora :) Te pido que incluyas un comentario a este post. Si eres tímido, con tu nombre y lugar de residencia bastará... pero para mí será un placer sentirme acompañado! :) Prometo responder a todos! :)

Un abrazo! y nos vemos por Llançà! :)